Solar Radiation...

Environmental stress can affect the survival of humans on a very negative scale. There are many different types of stressors but one of the worst is Solar Radiation. Humans have a granular substance in their pigment produced by their cells which is called Melanin; this helps to combat solar radiation but doesn’t stop it completely. It acts as built in sunburn because it absorbs UV light that could be very dangerous.  Not everybody has the proper levels of melanin though and this can lead to serious consequences such as skin cancer.

One way that early humans adapted was to wear animal skins or other types of clothing wear blocked the UV rays. A second way was the protective mechanism of “tanning”. When the skin was exposed to sunlight the body started to and it temporarily increased melanin production. A third way was a bit of a longer adaption because it was the pigmentation of hominids from different places on the planet changed over time and stayed that color permanently. This meant that they were better protected against the UV rays from that area.

From this perspective human variation comes across very beneficial. This is good because it can help us discover other things such as new diseases or conditions that can arise as a result of the exposure to UV rays. This helped us learn about how the multitude of different pigmentations came to be that there currently are among the human race.

Different races or ethnicities have different pigmentation based on the areas that they originated from. Their pigmentation is based again on the melanin substance building the natural sun block against the UV rays that come from the sun. Environmental variations and influences are a better way to understand human variation than race because many people identify with different races rather than their ethnicity. Many individuals also have multiple ethnicities and may identify with one race more than the other.

Language Post....

                                                Part 1 (nonverbal communication with a partner)

·         I found this part of the experiment difficult at first. I found it funny because it was almost like charades. After a while it became easier because I could use my hands or nod or make noises to signify I liked something or not. I did this experiment with my nephews and husband. I had my husband attempt to translate what I was trying to communicate.  I’m a bit of a talker so it was hard to think about how I could communicate what I wanted to say without speaking. My nephews are younger so they were such good sports. They thought it was like a game.  They would grab things and point to objects and ask me “is this what you want or do you want this?” The experiment was fun but it became more frustrating when we started working on a craft I had brought for the boys. It was a foam toy shop that we were supposed to connect and put together. They lost a bunch of the pieces because they weren’t listening to my husband who was trying to get them to stop. I was frustrated because I’m pretty firm and would have taken the craft away if they weren’t listening but my husband only thought I was trying to get them to give him the pieces.

·         If I were in the situation of meeting a different culture and my culture was not able to communicate verbally, I would think the other culture would think they were more advanced than ours. The culture that is able to speak has a clear advantage when it comes to communicating complex ideas. I would think the other speaking culture might look at my culture as barbaric because I would need to use my hands and body to communicate rather than using my voice. However in today’s society we treat Individuals who are deaf with respect and compassion. We try and accommodate anyone’s disability. Individuals who are deaf are able to communicate using sign language or by reading lips. Many deaf people may even have an interrupter who can assist them in communicating to others who are not familiar with sign language.

                                                Part 2 (communication without using hands or tone)

·         I was able to last for the full 15 minutes, however I felt like I stopped trying to start up conversations after the first 10 minutes. I am a big talker and I guess I’m a hands talker. I also have a bit of a strong personality and it was hard not to let it out. I felt a bit robotic and I felt like people thought I wasn’t interested in what they were saying because I remained monotone.

·         I think the partners who I interacted with found it challenging to talk to me. At first it was funny because I sounded like a cave man but then it became hard to keep conversations going.  I think by not changing my tone at certain parts of the conversation made it sound like I wasn’t interested or didn’t care.

·         I guess this experiment really showed how we use our whole bodies to communicate. I think we use our hands and voice as a way of expressing our selves. Not just in what we want to say but also in who we are. You can learn a lot about someone from having a conversation with them, you can also learn about their personality if they are shy or outgoing.

·         Some individuals who are autistic have a hard time reading facial expressions or body cues. Learning that we use our bodies to express all types of emotions can be really beneficial. It can help them in the future to look for characteristics that one might try and express non-verbally.  I don’t believe there aren’t any benefits to reading body language. Often time we express our selves through are body and are not fully aware of it. If I am mad or angry at someone I often will give them the silent treatment until I am able to express what I need to say in words. Most people are able to pick up on peoples attitudes or feelings by the way they are using their body language.

Piltdown Hoax........

1)      In the late 1800’s and early 1900’s early human remains were found. These remains resembled humans but were not what humans looked like today. I believed that the remains that were being found were of early human life which was later called Neanderthals. The remains were first discovered in Germany and later in France and Spain.  The British had who believed that early man started in England, were upset because they had no discoveries. In 1912 a well known English archeologist named Charles Dawson claimed to discover human remains that were both man and ape. This was then known as the “missing link” in human evolution. Which was later called the “Piltdown man”. It was later discovered in the 1950’s that the fossils from the Piltdown man were proven to be fake. This caused an uproar in the scienctific community and made many question the human evolution process.

2)      Because all scientists are human they are susceptible to normal human emotions such as pride, greed, envy, and anger. I believe whoever the conspirators were involved in the Piltdown man were arrogant and wanted recognition in this early life discovery. I believe the conspirators were prideful and wanted the credibility that early man first started in England.  Unfortunately for these conspirators our technology advanced greatly in the next few decades and Scientist were able to test the age of fossils. This is when the discovery of the Piltdown hoax was made.

3)      Scientist were able to test the fossils by a new dating technique called “the fluorine absorption test” Which uses the fluorine to determine the duration of time an object found in the ground has been there. They also discovered that the fossils were a combination of human and ape remains. They were able to discover that the bones had been stained with an iron solution and chromic acid, and the teeth were examined using a microscope and scientists learned that they were filed down to appear like human teeth.

4)      Even if we wanted to remove human’s bias from future science we would not be able too. Humans are always going to have emotions that can affect their work. I would not want to remove the “human factor” from science. If it weren’t for scientist passion, rebellion, persistence, and drive we would not be as advanced as we are today.

5)      I believe the life lesson I learned is  you should be cautious and not believe everything you see and hear. Be open minded but not easily influenced, and take the time to determine your own beliefs.

Locomotion in Primates

                                              Locomotion in Primates

Lemurs are found in an island off the East Coast of Africa called Madagascar.  Madagascar is made up of savanna and rain forest. The lemurs are found in the tropical rainforest.  Lemurs have a form of quadrupedal movement in which they use all four or their limbs to support their body. They use vertical clinging and leaping for their types of movement. Lemurs use their limbs to leap and cling to better adapt to the trees in the rainforest.

Spider Monkeys are found in central and south America in the tropical rainforest’s. Spider monkeys leap and swing their arms. They are known as semibrachiators. They live in the upper rainforest in the canopy. They have adapted to their environment by using their arms to swing to the higher branches of the rain forest.

Baboons are found in Africa, India, Japan, and China. They are found in many different types of environments. They are extremely adaptable to their habitat. Baboons are quadrupedal primates. They use all four of their limbs to support their body. Because baboons are found in multiple environments they have adapted to life on the ground.

Gibbons are found in Asia. They live in the tropical rainforest and monsoon forest. They use their limbs for hanging and are considered more dedicated to brachiating than other primates. The gibbon’s arms and fingers are long which help them swing and hang in the many trees found in the rain and monsoon forest.

Chimpanzees are found in equatorial Africa and in the west of lake Tanganyika. They are quadaredal primates that use their limbs to support their weight evenly. When chimpanzees are younger they may branchiate more. Using their arms to swing from branches.  Chimpanzee have adapted to life on the ground. They are able to walk on the ground while caring objects and food. They use their knuckles to help support their balance and weight.

Week 2 Alternative Codon Code......

TGGGATGACACCTCTGAATTCACTTGCCCGATA

The Scientific Method......

1-2) It is my belief that the student falling asleep in the back of my class is very tired. I believe he must work late or not get enough sleep at night, which is why it is difficult for him to stay awake in class. I ask to observe him in his natural environment and discover that he works a graveyard shift and does not get enough sleep during the day. I ask the student to get a minimum of 8 hours of sleep per day to see if there is a change in alertness.  After a few days of receiving more rest the student is able to participate more in class. He still is quiet but at least is more involved.

2)  It is possible while doing my observation that I learn that the student has classes during all times of the day and is not able to get consecutive hours of sleep. As a result he gets broken sleep and is restless, which leads him to fall asleep during class.

3)  The student could be diagnosed as a troubled sleeper and may have narcolepsy. This would enable him to sleep at random times beyond his control.

By: Kelly Morales-Barry

Darwins Influence.....

*It is my belief that Charles Darwin was most influenced by Thomas Malthus. It was in an essay that Malthus wrote titled “Essay on the Principal of Population” where Darwin was inspired and intrigued.  Malthus’s theme for his writing was “The population growth would always overpower food supply growth, creating perpetual state of hunger, disease, and struggle.” This inspired Darwin to learn more about the natural selection process and helped him develop his theory of evolution. I believe if Darwin wasn’t influenced by Malthus than his theories and ideas wouldn’t have come to completion. Although Darwin had other influences it is said that if the if “Evolution was the machine and natural selection was the engine, then Malthus perpetual struggle for resources was the fuel.”(http://www.allaboutscience.org/thomas-malthus-faq.htm)

*Darwin was very cautious of who he spoke with about his theory before he made his ideas public. He knew that many would not accept his theory of evolution because it went against what was said in Genesis and what was believed at the time. It was his courage and boldness that helped change the way we look at the world.

http://homepage.newschool.edu/het//profiles/malthus.htm

http://www.allaboutscience.org/thomas-malthus-faq.htm

By Kelly Morales-Barry